Subject	if i want a freakin kidney, why shouldnt i be allowed to hav
Posted by	Jefe on April 05, 2002 at 11:55 AM
	This message has been viewed 19 times.
In Reply To	Human cloning certainly is questionable..... posted by Aseem on April 05, 2002 at 07:54 AM
Message	e one? what the heck is the difference between that and getting a donor kidney? i would say the former is better because you get your OWN DNA, and the other guy gets to keep his. you cant lose! (except money) Jefe
Follow Ups	NZR - But Ground Breaking..Human Cloning has offically begun - [-TRM in TPA-] 07:38:24 04/05/02 Human cloning certainly is questionable..... - Aseem 07:54:32 04/05/02 True - [-TRM in TPA-] 07:56:58 04/05/02 LOL, So is human bgreeding in Georgia, but I dont hear - AshsZ (Fab Whore, Ph.D) 08:51:46 04/05/02 Don't agree with you at all............. - Aseem 08:55:35 04/05/02 You MUST be inbred. :-D (n/m) - AshsZ (Fab Whore, Ph.D) 09:03:06 04/05/02 Your argument is of course very logikal....:-0 (n/m) - Aseem 09:12:54 04/05/02 Damn inbred Georgians. :) LOL jk (n/m) - AshsZ (Fab Whore, Ph.D) 09:43:59 04/05/02 if i want a freakin kidney, why shouldnt i be allowed to hav - Jefe 11:55:12 04/05/02 not arguing with you on OEM parts..hey I want to be hung - Aseem 12:08:26 04/05/02 OEM sucks.... - ghoztt 13:23:58 04/05/02 Why does man always feel compelled to attempt>> - FiremanZ 08:01:46 04/05/02 Yup, it's easy to copy stuff when you have the blueprint, - Aseem 08:04:32 04/05/02 This is a bad direction to take this Bob. (n/m) - JRH(KY) 08:18:36 04/05/02 You're right. Didn't mean to start a debate, just> - FiremanZ 08:46:50 04/05/02 Don't sweat it. We all know how quickly this kind of thing - JRH(KY) 08:50:36 04/05/02 Hey OI resemble that remark LOL (n/m) - RT 09:03:01 04/05/02 I dont think that applies to this >>> - AshsZ (Fab Whore, Ph.D) 08:54:26 04/05/02 As usual the main reason that "SCIENTISTS" are interested - Aseem 08:57:48 04/05/02 If there wasn't the promise of big money... - JRH(KY) 09:02:56 04/05/02 Not true...in some countries healthcare amounts to - Aseem 09:17:04 04/05/02 Money is good MAN is evil. hehe (n/m) - RT 10:09:36 04/05/02 lol... (n/m) - Aseem 12:06:44 04/05/02 You couldn't be more wrong - Brooks 12:12:17 04/05/02 Sorry dude don't agree I've been in the game for a while - Aseem 12:14:32 04/05/02 I hope all people in the profession aren't as cynical as you - Brooks 12:23:32 04/05/02 Dude, I hear your points loud and clear, we just - Aseem 12:55:20 04/05/02 Ash's next project.... - ghoztt 13:45:22 04/05/02 I'll take one Melissa Joan Hart to go please. (n/m) - JRH(KY) 08:08:40 04/05/02 Hmmm order the girl of your dreams, this could be cool LOL (n/m) - RT 08:17:11 04/05/02 If anyone request Molly and Dolly, I'm atta here... (n/m) - Aseem 08:24:15 04/05/02 Of course it'll be cool. The world will be a better place - JRH(KY) 08:24:21 04/05/02 Unless they cloned JackB, that would ruin it all LOL (n/m) - RT 08:47:01 04/05/02 lol (n/m) - Atti2de 08:49:41 04/05/02 I'll take Eliza Dushku to go please...wait - [-TRM in TPA-] 08:30:29 04/05/02 that would be GATTCCGGCCTTACCTTAAAAGGGTCGAAGTTTAG - Aseem 08:35:53 04/05/02 Precisely! (n/m) - [-TRM in TPA-] 08:45:19 04/05/02 How about Elizabeth Hurley. She's my dream and accent to go! (n/m) - zman92(ATL) 09:04:02 04/05/02 2nd...Did she look hot in that devil flick or what.. (n/m) - Aseem 09:23:03 04/05/02 Bedazzled...was the flick...and yes she was smokin! (n/m) - [-TRM in TPA-] 09:58:07 04/05/02 yes....I'll take one Elizabeth Hurley as well (n/m) - NissanRacing98 (OH) 11:58:01 04/05/02 Those Italian bastards.This is the downfall.no doubt. (n/m) - josh 08:09:04 04/05/02 Excuse me? Italians are the only ones worth being cloned! - Atti2de 08:31:04 04/05/02 loo. I'm not saying Italians are bastards, only the ones - josh 08:51:25 04/05/02 LOL I forgot my j/k on that last post :) (n/m) - Atti2de 08:59:06 04/05/02 Well I wouldnt go that far! :-) (n/m) - TARGETZ 09:56:43 04/05/02 And what the general public does not realize.... - Aseem 08:18:09 04/05/02 Do you really think the Italians are the only ones doing - Atti2de 08:35:31 04/05/02 We'll just have to clone Atti2de so one can work and make - SpeedyZX 09:12:01 04/05/02 May god help their souls---forget the afghans...let's take - z-extreme 09:16:40 04/05/02 What the hell are you people afraid of??? - Grec (East Bay, CA) 09:56:46 04/05/02 This is not our job...I am sorry but in my view it falls--> - z-extreme 10:05:57 04/05/02 God gave man the brains to learn and discover so where>> - RT 10:08:48 04/05/02 God also gave man the right to choose to do wrong and right- - z-extreme 10:14:59 04/05/02 Good idea, I see no real answer just more questions:) (n/m) - RT 10:18:39 04/05/02 Exactly...... - AdamTTZ(Jersey) 12:40:35 04/05/02 they know nothing about it b/c it just began, like everythin - Chris (NJ) 10:43:42 04/05/02 Who are you to say whose job it is? - Brooks 12:29:53 04/05/02 Yeah nuclear technology was supposed to be beneficial too-- - z-extreme 14:55:14 04/05/02 All "right or wrong" aside: This was NOT THE TIME to do it>> - SeedyRom 12:20:36 04/05/02 Re: All "right or wrong" aside: This was NOT THE TIME to do - ghoztt 12:35:05 04/05/02 interesting thought.... - ghoztt 12:48:55 04/05/02 Indeed... - SeedyRom 13:22:44 04/05/02 i was wondering teh same thing - Jefe 13:33:21 04/05/02 Re: i was wondering teh same thing - ghoztt 13:39:43 04/05/02 I couldn't agree more >>> - Brooks 12:51:04 04/05/02 "i have eighty-six, top quality, aborted fetuses here bob" - Jefe 13:36:01 04/05/02 those scientists are screwballs (n/m) - Kez43 12:09:55 04/05/02 If you take home one message ^^^^^ this is it....LOL.. (n/m) - Aseem 12:22:42 04/05/02 Some facts that I think are being misrepresented... - AdamTTZ(Jersey) 12:56:10 04/05/02 gonads and strife! (n/m) - got rice? 16:33:56 04/05/02
Post a Followup	You cannot reply to this message because you are not logged in.